The Coming European AIDS Epidemic
Other urls found in this thread:
hivinsite.ucsf.edu
archive.is
breitbart.com
archive.is
youtube.com
independent.co.uk
archive.is
archive.is
forbes.com
rt.com
duesberg.com
archive.is
snagfilms.com
en.wikipedia.org
youtube.com
libgen.io
robotictechnologyinc.com
archive.is
forums.phoenixrising.me
en.wikipedia.org
twitter.com
I'd love to say this is retarded larping bullshit, but then I remember that California decriminalized purposefully infecting people with HIV a few months ago…
Same here. Seems dumb as fuck, but it has everything that jews love:
1. Afflicting the goyim
2. Making money while doing 1.
It's possible it's being done by the AIDS drugs lobby to make more shekels, can't discount that. But if the Jews want to kill us, I'd be more on the lookout for Ebola. And we will indeed see Ebola before this summer is over, count on that….
Can't make money of dead goys if you use ebola.
Hypothetically, would it then be legal to find a mud with AIDS and pay it to have liaisons with mud sharks? The danger though is that White men who don[t know it[s a mud shark might end up with it too. If it really is now "legal" to spread AIDS knowingly…do you have a link user?
I sort of know 99% it must be true but I need to see for myself Commiefornia is that bad.
words on a screen aren't LARP you retard.
Killing white people has always been the agenda. They are competition for rich families.
true user, but I think on the whole they re more interested in killing us than even getting our shekels. Use as an example….look how they've destroyed their own video game and movie industry and how much money they are using simply because they won't even ease up on the filth…
LOSING
It used to be a crime, potentially even considered premeditated murder to infect someone without warning them in advance of your condition. Now there's a lot of shit about how certain drugs will make it """VIRTUALLY""" impossible to give someone a proper pozload and how they shouldn't have to tell anyone because, like all marxist college bullshit, it's oppression if someone is denied anything because of who they are or what they've done or what body parts they've mutilated.
The best I can figure is that an HIV/AIDS epidemic would be grounds for new government programs and social engineering about how it's wrong to oppress "Viral citizens" or the "Immuno-Challenged" or some other newspeak used to fudge the fact that these people are carrying a deadly illness. This creates an issue for lefty/marxist faggots to harp on and autistically screech about on social media, but it gives politicians an angle to secure voters. The party of free HIV/AIDS treatment and anti-Pozz discrimination laws will have a new angle to attack the more conservative kinds who'd rather let all the butt-plunging degenerates die.
Sorry for my english, is shitty as fuck and i dont have time, what kind of strain are we talking here? as we all know a lot of "people of the north" have a mutation in his ccr5 gen (called delta 32) not allowing them to have aids, but still being carriers, but a new one can "jump" that, what is the purpose of this? creating and disseminating a new strain for non rhesus?
As we all know politics is one thing, maybe one revolt, a big war and shit happens, but the genetic pool cant be recovered.
It might also be a depopulation technique, maybe even a bioengineering scheme to eliminate those predisposed to being sexually promiscuous (having sex outside of marriage), drug addiction and/or poverty. Maybe not, but it could end up having such an affect regardless.
Get the vast percentages of population infected with HIV. Puts a major strain on the industry to supply retrovirals and HIV treatment medicines, prices go up, people clamoring for treatment and cures.
Then you pull the plug out on everyone. Say in 2025-2035 timeframe. Big market crash combined with famines (due to a hibernating Sun) limiting the food supply. Vagrants everywhere who can no longer afford their HIV medication. Mass die off.
Maybe even the kikes hinted this was going to happen in the movie Looper… youtube.com
If anyone here had yet to do so, either read or listen to audio of "Gulag Archipelago," Vols 1-3. Solzhenitsyn does an amazing job of naming the Jew in-between the lines so people who already knew the score cos tell what was going on, but without going too far the Jews could use it as an excuse not to publish it.
The Jews who ran the Gulags were worse and far more cruel than any serf-owner. The had simply killed all the gentiles of they could take they place as the estate owners. Also, since these patrimonies were not for life, the Jews seen every spare minute stealing all they could.
When new female prisoners wold come in, they'd be paraded before the leering likes so they could pick their new mistresses. Solzhenitsyn describes the case of this that had had the most impact on him, a tall, beautiful girl who had been a 1st LT in the army and a sniper was helped by his fellow Jew Trustees to force her into sleeping with him. She was given the worst rags, put on the hardest general work, given the lowest scraps, until she finally gave in to this repulsive Jew hunchback.
No one can ever understand the Jews and the reality of what they did to the Russian, Ukrainian, and Balkan peoples until you've read "The Gulag Archipelago." It's a must read, I've read.listened to audio 4 times now, which is no mean set since it's ~2,200 pages. But it's well worth it. You'll have ammo to use against the Jews for the rest of your life and, if you know the book well, no Jew will ever be able to argue with you, they'll simply flee or try to change the topic or swear at you.
this is beyond stupid. if they wanted these kinds of people to die off they wouldn't waste so much money on welfare for them. it's all about creating a slave caste and more government teats.
MY apologies, English not my first or even second language, apologize for poor grammar, if anyone is interested in post and wants me to fix it I will.
dehumanise yourself, protect your face during the bloodshed
This. Again, go back to Solzhenitsyn. These people, the criminals, are the "socially friendly" elements, the rabble that the Jews want to use as the vanguard to destroy the productive (e.g. "socially hostile") elements.
in Gulag, Jews always put the thieves in charge of the 58s (the "socially hostile") elements.
Then you pull the plug out on everyone. Say in 2025-2035 timeframe. Big market crash combined with famines (due to a hibernating Sun) limiting the food supply. Vagrants everywhere who can no longer afford their HIV medication. Mass die off.
Thats relative to the strain, something out of siv will be literally the death of a certain race and a scarlet A in the face of mudsharks.
*BALTIC people of course.
Thing to remember about jews is that they think that the goyim are too stupid (and jews are too smart) for them to ever get caught. Hence a long-term goy-farming thing like this.
Any time I start to feel pity for jews something like this happens.
Every male jew must be castrated and raped by HIV+ niggers. Every female jew must experience the same.
By these years, you can also expect massive, massive famine in Africa. The South African kaffirs are in process right now of kicking Whites of their farm and "redistributing" the land. Did they learn a thing from Zimbabwe? They learned they can stay in power a few decades longer, even if they have to eat rats, and that the West (!!!) will help feed them.
Rhodesia was the most productive area of Africa that fed almost the entire continent. South Africa is already a net importer of grain since they've managed to murder 3% of all farmers. When the SA ran was reduced to junk by all 3 rating agencies, in South Africa searches for "how to emigrate from SA" increased by 250%.
If fat kim and Zog don't destroy the world by then, wait and see the famine in south Africa. These fucking niggers don't realize they have by far the highest living standard in the HISTORY of Africa, but now with the internet niggers can compare their own lives to those of Europeans.
If you don't follow the news in SA, look up "free, decolonized education" which is what the niggers in SA claim they want. Now exactly what "decolonized" means they cannot agree, since the negro never even intended the wheel on his own. But I'm not kidding when I say they want to literally wreck the unis (they've already burned down a law library with antique books dating back to early 17th century).
What did these negroes learn from Zim? When you have IQs in the mid 60s you aren't capable of learning. Thus the daffier is vulnerable to negrooes like mandela with slightly high IQs who promise shit they know they can never deliver.
Look at "mike smith's political commentary" 9even though he is a jew-lover and can't seem to realize the jews pulled the rug right out from under his feet). But, amazingly, after many years of arguing with the this Jan from SA who ran Africrisis, one might it hit him like a lot of lightning as he was reading about commie jews like rosa luxembourg in Germany and what they were up to.
So, bottom line is that even for people as fucking brainwashed as the Afrikaners, they can be woken up, and no one can ever tell quite what will be that bolt of lightning. I has been arguing on and off with this guy since I was fucking 15, and he'd ban me from his pages, which was a shame since the had great info on arica, farm murders, and communism, but would never mention the Jews and you would get banned for doing so.
Then like a miracle, one day out of nowhere I checked the page and this was at the top along with a slew of articles related to Jews and communism.
TL;DR- Even BOERS can be reached, believe it or not.
Please don't tell me that user, I can only bear so much bloodlust.
Africa starving to death is a given but the real question is whether or not other nations will have a leader that forces their people to join them. All African aid should be cut off immediately and any white natives relocated to safer places.
Also, one last post and then will shut up– what would be the logistics of helped to arrange a trip for WHITE SOUTH AFRICANS to Libya and then a boat to Europe? The same way the Kaffiers do, only ensure a better boat, less crowing, phones, flares, a good captain, etc..?
How much would we need to raise do you think, and would the jews on kickstarter kick us off? Would the E-Jews have the balls to actually not allow them in since they are White? According to genocide watch, White South Africans are between stages 6 and 7. I think they could certainly get a court hearing. I don't know if
hat And the best part (not sure if still there) were a bunch of negresses complaining on twitter that Whites were worried about books when they claimed a negress was raped at a police station (all horse shit of course). Let me see if those tweets still around. Talk about bloodlust, tHAT, mate, will do it for you..
There were more than enough opportunities yet it didn't go into full blown epidemic. And now the prevention measure are made even in the elementary with educating the young.
Why would it be different now? The only ones that get hiv are homosexuals, druggies and promiscuous people. None of them are majority.
Plus, hiv levels in muslim countries are a lot lower than Europe or America, mainly becouse they don't approve of gay bars or other places where they bug chase.
I would worry about ZIKA, tuberculosis or any other old infectious disease.
More reason to not racemix.
More reason to leave the cities.
More reason to stop being degenerate.
More reason to dehumanize yourself and face to blood avoidance.
I'm ok with this.
...
these digits
gotta love the liberal mindset that social cohesion will obviously be the only logical conclusion as everyone naturally accepts all new rules and regulations without question or exception
i hate the fact that no one has publicly questioned the study design that argues for prep treatment. considering the high-risk population being considered for treatment is expected to still tested regularly for HIV, the worst-case scenario without prep treatment is about 3 months of untreated HIV. to my understanding, there is with the same drugs used for prep treatment as HIV treatment there is no cost-savings with either option and no difference in rates of adverse drug reactions (a significant medical cost). people who contract HIV, but get treatment early (defined by CD4 count >350k cells/cc) have equal or greater lifespan than HIV negative people (per aidsmap archive.is
Obviously drug makers realized that since they'd hit the ceiling on lengthening lifespan they needed a new avenue for their drug. How can you increase the use of a drug designed to prevent its own need? Increasing the population indicated for the drug is the only logical choice besides coaxing more resistant strains (which is probably still on the back burner, but was more difficult for viruses to develop than bacteria)
*preemptive rebuttal archive.is
need to include equipment for livestream(s) during the entire journey so (((pirates or natural disasters or terrorists or accidents))) don't take out the boat
you may consider comparing this cost to the cost of what feeding the "malnourished" populace of Africa should cost @$0.09/meal, used as the commonly cited figure when charities cite meals donated instead of $ given (common on marketing materials geared toward gen pub), vs how much is donated annually to these causes collectively (consider giving an estimate range rather than a single number)
This is why the strain is important, some nords can stay in a nigro orgy without giving a fuck while some groids will die for just fucking a slut with a condom (check id) AIDS started a gorillion of years ago from blacks fucking/eating/fighting apes and some monkeys with siv, then that shit mutated to get attached to people having a "normal" ccr5 protein, but a lot of blondies dont have that shit, this is why some conspiratards are saying that aids was created for control population, aids isnt created, sadly is natural or the outcome of black magic. Fun fact, there are lot of aids "created", some with just one person in the world (maybe) while others even have siv in their bloods (blacks in africa, 3% of population in some parts).
After that its being clear that having "normal aids" isnt the same as having new and weird strains that can get attached to proteins common in whites and "normal aids" is already endemic to europe.
Its a well knowed fact that destroying whites is the same as destroying blacks, if blacks are lucky slavery without castration will return, but after seing what muslims did with blacks is obvious that they will be castrated.
Fucking kikes, you know they will be controlling the cure and distributing it only to the good goyim, while letting the bad goyim die.
Another Deus Ex prediction comes true.
Too late for that user:
Elise Knutsen , CONTRIBUTOR
I cover international movers and shakers.
Opinions expressed by Forbes Contributors are their own.
English: Flag of Israel with the Mediterranean…
Israeli Flag (Photo credit: Wikipedia)
"This weekend, a report revealing that African women immigrating to Israel were subjected to mandatory contraceptive injections, effectively amounting to forced (if temporary) sterilization made global headlines.
Some 130,000 Ethiopians, most of them Jewish, live in Israel. The community experiences higher poverty and unemployment rates than the rest of the country's Jewish population. In the past decade, the birth rate among Ethiopian-Israelis has declined by at least 20 percent. Advocacy groups now claim this decline is the result of a birth control regimen forced upon Ethiopian immigrant women.
According to an article in Haaretz, an Israeli news source, one Ethiopian immigrant said that the doctors who injected her claimed that “people who frequently give birth suffer.” While it is possible, if highly unlikely, that doctors genuinely had the women’s health in mind when they forcibly injected them with contraceptives, there is no excuse for depriving women sovereignty over their own reproductive choices.
Israel has acknowledged the issue (without admitting any wrongdoing) and has vowed institutional changes in healthcare for immigrants. By decree of Israel’s health minister, gynecologists have been ordered "not to renew prescriptions for Depo-Provera for women of Ethiopian origin if for any reason there is concern that they might not understand the ramifications of the treatment."
This does sound like a very plausible side-effect but it seems like a rather slow strategy compared to just flooding Europe with chimps and letting them do their chimp things.
N.B.- you've probably not even heard about this. Now try, just TRY to imagine if it were Serbs or Hungarians doing it to gypos. The fucking KIKES would demand (and get) WAR from the entire UN.
IF anyone here is a big Molyeneux fan, would love to have him comment on this. This article is from Forbes but just google "Jews, Ethiopia, Israel. Provera-Depot." It's everywhere (albeit on the very last page do none of the lemmings notice on the way to the sports section).
This is another GREAT, GREAT MEME TOPIC. #ISraelStopEthnicCleaning and just run with it from there. IF we could get just ONE FAMOUS NIGGER RAPPER to tweet about this crap, we could have the niggers at the Jews' throats while we sit back and watch like Christmas Morning.
If the kikes were interested in depopulation our governments wouldn't be sending food to Africa. It would be really fucking easy to shed a few billion people just by cutting off foreign food aid. I think this is probably not a real plan, because it can't work (for the same reasons that AIDS is still almost exclusively a gay and black disease in the US–straight white people practically never fuck niggers, and normal heterosexual sex doesn't transmit HIV very well), but if it is real it's about creating dependence and killing white people.
I wish this really was the real plot because it would just mean all the degenerates would die instead of us being replaced by animals who populate at 5x the rate of us.
A succinct microcosm of the attitudes that are slowly killing us as a people. May the Jew pay for this with more than shekels.
Jesus how we could redial the fucking masses on the Jews if we could get this info out. We need…I'm going to send some tine building a plausible twitter cover as a nigger activist. I already have a very deep one as a Palestinian "activist" to rouse the rabble against the Jews.
Have to see if I can be clever enough with my "#HateWhiter and #GetTheHokeyCat stuff to get a large nigger following, and then act like I just SUDDENLY found out about the Jews faint this. They'll shut me down vert quickly, which is why would also need a FB page of an imaginary nigger to use. LOOK AT THIS SHIT
"Ethiopian women have told RT that Israeli medics forced them to take the controversial Depo-Provera birth control vaccination without explaining the severe side effects of the drug, which can leave a woman unable to become pregnant for up to two years.
The birth control vaccination was reportedly a requirement for the women to immigrate to Israel: “They told me if you don't take the shot, we won't give you a ticket, so I took the shot, but I didn't know that it would prevent pregnancies. I didn’t know,” one woman told RT correspondent Paula Slier.
The gruesome side effects of Depo-Provera are so severe that the drug is not recommended for most patients.
“We are talking about a contraception that has heavy medical and mental effects – period irregularities, vaginal bleeding, osteoporosis, alongside mental side effects like depression, mood swings, rage and more,” said Sharon Eliyahu-Chai of the Association for Civil Rights in Israel.
At least six organizations – such as Tebeka, an Ethiopian legal aid group – now aim to take the matter to court over alleged human rights violations.
Last month, the Israeli Health Ministry’s director general ordered gynecologists to cease administration of the drugs, bowing to public pressure after accusations that they had been forcing the birth control injections on Ethiopian women without their consent.
Israeli officials have denied that the birth control program was part of a plan to reduce the Ethiopian birthrate. The scandal has worn on, with the organizations involved all pinning blame on one another."
Niggers are already living aids. That user is missing the forest for the trees.
OY VEY
Why contain it?
HIV does not cause AIDS. You've been tricked by one of the largest Kike scams besides the Holohoax.
>>>duesberg.com
I'm not archiving so Duesberg gets hits. No, he isn't Jewish
HIV is still extremely shitty to have though
what kind of bad goyim gets HIV, when it's synonymous with the three H's Haitians(blacks), homos and heroin addicts. All people we could easily do without. I mean they could attempt to spread this shit to whites via rapes and other means as described in OP, but that seems a stretch and could foment things (((they))) don't like. Public health death squads when?
HIV is only a retrovirus. At worst, it would cause a small problem, like any other virus (rhinovirus, etc.). The real killer is AIDS, and we still don't know what causes it.
My guess is Jews.
remove the tinfoil from your eyes, HIV causes AIDS and the mechanism is well-known and documented. Go catch it in someplace and see what happens.
In all seriousness, Deusberg and other think it is related to "poppers", something cocksucking faggots take to keep their dicks hard. Taking too many could be carcinogenic, leading to cancer (1 of the 6 causes, at least). I don't think Jews are involved, because they would spread it to white people, and children of white people.
HIV is a retrovirus, and most likely harmless at that, as I mentioned. It fails Koch's postulates, so it may not even exist. More likely, Jews capitalized on Western ignorance to science for a profit. "Oy vey Goy, take these kiek pills to cure your HIV, which actually give you AIDS, so we can charge you for chemo too"
cool story broski
You still believe that (((conspiracy theories))) don't exist? You're on Holla Forums for Christ sake. Look up Robert Willner. It's also not "well known." prove it.
They will and they are.
kys kid
Fuck off back to 4chan, you fucking 14 year old summer child. If you're a shill, blow your fucking brains out.
Reported for being a kike shill.
You don't even know the very basics of science, take off the tinfoil and open a statistics book. All people like you do is make it easier to hide the real shit by devaluing other conspiracy theorists who actually aren't ignorant as dogshit.
Ah the typical 'no u' kike reply.
Most race-mixers and faggots are non-white, but it definitely seems like an attack on white countries. Inject a disease in an animal, then release it.
((((((((((((Deusberg))))))))))))))
He isnt a jew, unlike you.
Once again, another dumbfuck thinks every "stein" or "berg" or "Braun" means Kike. Fucking kill yourself.
Then once we are depopulated that would just show the need for even more migrants
Really makes you think
Hello 4chan shill
You aren't helping your case m8
Another non-argument. Reported for the fourth time.
I guess you're new here, otherwise you'd know what happens the moment someone mentions actual facts and data gained therough the scientific method.
ADDDMINNNNN RDMMM
Keep crying you fucking kike.
Cool non-sequitur argument, you massive faggot. How does working at Berkley mean Deusberg can't make a logical, correct theory? Does that disprove the work he did to get his PHD? Are you the best shill they could drum up? The man hates niggers and faggots, and his a genius. You are a Jewish faggot working for the JIDF, making 4 shekels an hour.
Salty bro?
I bet Zuckerberg funds the cure.
You hooked nose fucks are going to die soon.
Does everyone see what's going on here? The minute I mentionec "HIV does not cause AIDS", I was swarmed with a ton of shills and arguments against me. The JIDF is out in full force. Fuck you all, you'll never win, you'll lose the Holohoax too.
:U)
You can't repopulate with only gays user.
Even if it's gay migrants.
Here's your (You), Kike bastard. Anyone interested, I implore you to read Willner's "Deadly Deception." It's top notch stuff.
So anyone who is at Berkely is a Communist Jew Cultural Marxist unless they support your story then they are an Aryan Genius Scienceman, huh?
Funny how that works, isn't it?
snagfilms.com
great documentary on buggchasing, the homosexual practice of catching hiv on purpose.
He's only here because he is paid to cover this up or to drail. Just report him
See here another "argument" from a kike. Keep shotgunning you filthy rat.
...
That shit's fucking hilarious/sick.
Heres your ((Jew))
:U)
I'm just a goy you hooknose. They must really pay you next to nothing for being such a bad shill.
more shitty cuckchan larping
Let me give you at tip, Schlomo. Saying "no u hahah!!!" is not an argument. Go back to Kike school also known as my fucking oven, I set it to 723 K
tbh every race mixing degenerate white whore deserves to gets aids and die of it along with their nigglets.Only problem is that all those disgusting cunts and their nigglets will be on gov aid to pay for aids treatment off the backs of whites who don't do miscegenation.
OC
I know that from a right-wing kook perspective you may think that if you push the HIV doesn't cause AIDS angle hard enough, the state would stop funding research and stop paying for faggot GRID's treatment which would save a lot of taxpayer money and cause all the AIDS ridden faggots to die out. That be great. This is the reason the (((press))) fears 'AIDS denialism. But the fact is that HIV does cause AIDS, and you're just a kook for believing this shit and you're not gonna achieve your goal by pushing lies. This is why the American republicans are losing on climate change - because it's pushing a notion that's just not true - that human activity somehow doesn't impact climate, when really it does. By doing so and sticking with the republican conspiratard(not to say there aren't any legitimate conspiracies) party line you are alienating the normies (also pushing them to the left who are glad to capitalise on this) that care about nature(Europeans are a forest people and deeply care about nature, only desert dwelling savages do not care about nature) and you're shielding (((industry))) and the consumerism that fuels it while doing so. Quit bothering yourself with David Icke tier conspiracies, you're damaging your credibility, which lessens the possibility that people will consider the only (((conspiracy))) that matters.
I remember him talking about that story in one of his videos, pretty awesome to hear it from you
I guess it lines up with the pushing of degenerate sex culture which pushes 'free love' and destigmatizing the label of slut (to the detriment of the virtue of chastity) and telling men they are only men if they sleep with a lot of women as opposed to being the optimal provider and protector of your woman..
I came into this thread after reading , where the guy says that the women's sex talk included a thing about how STDs are no big deal.
Holy FUCK, that's scary.
...
I agree, though at the opposite end the 'Judeo-Christian' prudes are often harmful to healthy white psyche. SEX>FAMILY>NATION, by attacking healthy sex you are also weakening the latter two. This one of the reasons circumcision is so evil.
Nothing in that article is advocating forced migration, but is a response to forced migration. I'm not seeing any jewery here, not on the surface at least. Bad source to support your argument, OP.
This is much better.
AIR DROPPING ANTI-FAG FOLDER FOR SUPPORT
...
The company is Teva Pharmaceuticals.
...
en.wikipedia.org
"Teva Pharmaceutical Industries Ltd. (Hebrew: טבע תעשיות פרמצבטיות בע"מ) is an Israeli multinational pharmaceutical company headquartered in Petah Tikva, Israel."
BTW, for the fagits bound to only watch 3 minutes and conclude this is /fringe/ woowoo, no it's not. While it's made in the vein of early Alex Jones docs (that's the tech of the time), it's actually one hell of a Fedora video which shuts down most of the memeplex of modern religions and lays open a system of control exerted over the masses for centuries.
Sounds possible
Inside info?
It's too long for me to watch right now. What's the quick rundown?
Any rundown I give you would be a crime to the content.
It speaks of the origins of the memes (without using modern memetics language) and inebriation, enteogenics, how they relate to mind control, and what's been hiding in plain sight to all of us (but we lack the vision to see).
...
Sounds interesting, I've tabbed it for later
Underrated post and good advice. This plan is just crazy enough to be real, but if it is, the good side effect for us is the race-mixing mudsharks will develop MEGA-AIDS and die and leave more room for decent white Europeans to prosper.
A man can dream.
If it doesn't blow you away, you must be burned out on too much drug use in the past.
MEGA-AIDS MUD SHARKS
Syfy is really getting creative with these new movies.
Don't worry I have taken care of my brain
Good :^)~
[citation needed]
check out the potholer54 channel on jewtube. He has plenty of videos that do a good job at refuting the most popular myths spread about climate change and he always cites peer-reviewed articles. youtube.com
Link to cuckchan thread or archive?
Mate theres a link on the image in the upper right, or even in the OP of this thread. And both links give you the link to cuckchan as well in the archive.is page.
Good old (((peer review)))
HIV has become very manageable these days
you can spend 60 years gobbling down HAARTD's to stop AIDS from happening while HIV+
if your country has socialised healthcare they've got you on a short leash for the antivirals
if it doesnt theres a billion dollar industry you need to pay to be a part of so you can live
I've been wondering for awhile what happens to the women and children the fugees gangrape without a condom
how many of them are put on emergency antiviral treatment to lessen the chances of them contracting HIV
When you've finished watching you will be ready for these:
libgen.io
robotictechnologyinc.com
Then return to Pharmacratic Inquisition once again with your new-found oculi.
PING( , )
So wizards win again?
Just watch out for your cornhole brothers, you'll survive.
Though in all honesty I think this AIDS shit is counter intuitive to their actual plan, where you have a bunch of uneducated browns coming in to take out huge loans and feed into the debt slavery complex that requires shit tons of new rubes to keep in motion.
Movies are funded with your tax money goyim, why do they care.
By being hostile to nature and protecting (((industry))) you aren't doing yourself or your people any service. I assume you're from America or some other anti-white nation. Stop feeding the system. Also by supporting eco legislation you are helping to tear down the system that seeks to destroy and replace your people.
lol maybe…
into the trash
Not at all. I'm actually extremely concerned about real pollution. But no one is really focusing on that, or at best giving it lip service, because all the focus is on the bunk climatology nu-science. Just because greedy people speak out against climatolology when it threatens their profits doesn't mean it's valid science.
Actually I'm from Norway and I observe many real environmental threats even out here. Climate bunkum is not one of them.
Now, what if someone were to invest in Teva Pharmaceutical stock before this multi-billion dollar bullshit goes down?
BURN THE COAL PAY THE TOLL
The kikes are profit - taking too quickly while pushing the social shit. Two golem out of control.
TL;DR: Some shill tripping his cuck fetish.
No, that's just the modern jew.
STD's are no longer called diseases because it's bigoted. Now they're called Sexual Transmitted Illnesses or STI's.
T. I used to be a degenerate into BDSM / GAY SEX
...
First I heard of STI standing for that. Always heard it was Sexually Transmitted Infections.
Sure…
That dies before needing social security. AIDS helps with that part so the jews don't have to holocaust them.
Dark Researcher user?
Explain
Daily Reminder: HIV does not cause AIDS.
Pick one.
This is actually a really good idea. Could get some black nationalist retards like Tariq nasheed on it since he literally can't resist bait and would love to be the victim in any situation.
lol faggot
WTF
BRILLIANT!
Solid advice.
Since you got trips, something like that.
Behold the truth spoken in the word's of the apostles millenia ago:
2 Now we beseech you, brethren, by the coming of our Lord Jesus Christ, and by our gathering together unto him,
2 That ye be not soon shaken in mind, or be troubled, neither by spirit, nor by word, nor by letter as from us, as that the day of Christ is at hand.
3 Let no man deceive you by any means: for that day shall not come, except there come a falling away first, and that man of sin be revealed, the son of perdition;
4 Who opposeth and exalteth himself above all that is called God, or that is worshipped; so that he as God sitteth in the temple of God, shewing himself that he is God.
5 Remember ye not, that, when I was yet with you, I told you these things?
6 And now ye know what withholdeth that he might be revealed in his time.
7 For the mystery of iniquity doth already work: only he who now letteth will let, until he be taken out of the way.
8 And then shall that Wicked be revealed, whom the Lord shall consume with the spirit of his mouth, and shall destroy with the brightness of his coming:
9 Even him, whose coming is after the working of Satan with all power and signs and lying wonders,
10 And with all deceivableness of unrighteousness in them that perish; because they received not the love of the truth, that they might be saved.
11 And for this cause God shall send them strong delusion, that they should believe a lie:
12 That they all might be damned who believed not the truth, but had pleasure in unrighteousness.
Population control, huh? Now, why does that sound familiar…
writing the words in archaic high middle english doesnt sound so smart when you understand it as a native speaker tbh
simplified number 11. for some reason God will make you confused and believe stuff that isnt true
because thats more logical than kikes investing in pharmaceuticals then deliberately abetting a pandemic for selfish gain/material profit
this so much
so much this
sell it as the liberation of africa
Many Europeans are immune to aids since their ancestors survived the black plague, this is like flooding Africa with sickle cell anemia… Their resistance to malaria would protect them
Um, mine isn't listed on this guide, am I a god?
god? no
your ancestors were probably dirt poor plague riddled peasants in France, Germany, Britain or Italy though at some point
awws, that's probably true
those jews have been jews longer too, kept to themselves. isreal brought them in Operation Moses for this purpose, leaving their claim of Abraham's dependents the most "legitimate"
Probably a good thing
-/GTCAGTATCAATTCTGGAAGAATTTCCAGACA = DI
from thread you posted pg2
Tell me you faggots don`t believe this, AIDS isn`t as deadly as it was in the 80s, treatment has improved and patients can have relatively long lives, an epidemic would only put more economic pressure on european countries and the virus would spread disproportionally: Poor people and niggers would be more affected on average.
Flooding the country with cheap labor and increasing the consumer market is a big goal for the refugee crisis, OP is proposing the opposite. This just looks like something to distract considering what`s happening, just look at the stickies, shit`s going down
any proof of that? his kids look white as snow in his videos
he's Scandinavian, his wife is French. his kids may be white, but they're not of his culture, are they? they're foreign to his culture. the land of his blood and birth.
there was just an africa general on the front page, open your mind. hell i have entertained the flat earth shit before formally disagreeing
your home is full of houses
Okay I went on a rabbit trail and watched several related vids.
Assuming HIV doesn't cause AIDS, what specifically does cause it and what are the different ways it can help us, disadvantage us, or both?
Is it just a catch-all coalition of several immune diseases caused by entirely different things?
What are the ways to decrease it or increase it in different populations?
That's a very interesting observation.
If my memory serves me well, there was an epidemic of syphilis in Russian Empire right before the Bolshevik Revolution.
And in the US, during the elections year, when the tensions were raising, I've seen reports, that levels of sexually transmitted diseases (STI) are raising.
I was on the fence , my thought is that this was an elaborate 3 phase pump and dump using pol as a vector to get norimes to buy stock in an israeli pharmaceutical company
wanted to see how it would play out w/o anyone dissenting, thx
It's not to cause an AIDS epidemic, it's to breed out the white race via miscegenation. You don't get AIDS unless you get raw dogged by promiscuous faggots up the ass (semen-blood barrier) or if you're a heroin addict and share needles with all the other addicts (blood-blood barrier), or if you get donated blood from the former two groups (blood-blood barrier). The chance of an HIV+ man transmitting HIV to a woman via regular sexual intercourse (semen-vagina, not bloodstream unlike "anal" which causes microtears in the rectum because it's not designed for penetration) is 1-in-600-something. Very rare. And besides, some people think HIV itself is a benign scapegoat, and that AIDS/GRIDS is caused by the overloading of the immune system by typical promiscuous faggot and/or dopefiend behavior.
Moreover, the "African AIDS epidemic" is a scam for gibs from white countries. The more 'AIDS patients' they have, the more money they get, so of course the mechanism for determining who has AIDS is going to be very generous ("have you had unprotected sex?" "yea nigguh" "AIDS!").
I thought there were a large number of Europeans that were basically immune to AIDS though?
Also, this is Dr. Robert Gallo, the man who linked HIV to AIDS. He's supposedly 100% Italian but judge for yourself.
Must be something else to be a gay that isn't balls to the wall degenerate.
Nope, that's me. There's more of us former degens around that remember the crushing periods of emptiness and lonliness that said lifestyle creates.
Hell, it's worse, because all the folks you wanna fuck live far far away.
Describes me and my life as a freak, but as a gay wanting companionship, not to be thrown away like an empty box of smokes after the fun novelty wears off.
Faggots aren't human, gays are. The difference is the lack of sequins and dick talk.
In U.S. immigration, previously, HIV infection would render an alien inadmissible to the United States (= can't enter U.S. or obtain a green card). But thanks to 2010 public law introduced by Reps. (((Tom Lantos))) (D‒CA) and Henry Hyde (D‒IL), HIV infection was taken off the list of communicable diseases of public health concern.
That's odd, you might be thinking. Did HIV suddenly become less dangerous? Less communicable? Has it been cured, you daresay? The law in question authorizes foreign aid funding to HIV education programs in the developing world. So at the same time as (((they))) created educational programs targeted to HIV-endemic populations, they also stated, as an official matter of public policy, that HIV no longer poses a public health risk. Pretty neat, right? An alien with HIV can come right in; he doesn't even need to apply for a waiver.
archive.is/ALZl5
AHHHHHHHHHHHHHHHH
HIV aint even real
- clarification
Basically, the bill is largely about appropriating funds to foreign aid. But, in addition to creating AIDS classes for starving dindus, it also contains a small provision stating that HIV shall no longer be on a list of communicable diseases of public health significance. They mandated a (probably completely ineffective) solution to AIDS in the third world while also acting as though the problem has already been solved, and we can go ahead & start letting in people with AIDS.
Confirmed 100% italian shekelberger
It gets worse.
Anyone else having their browser open a new tab when replying to posts? It's annoying.
That image and comment.
We survived Regan, we'll survive Trump.
97% death rate over 20 years.
>surviving
Underated comment. Checked.
He must identify himself as an oven.
I cannot imagine how looking at wasted away people could be attractive.
It also bothers the mind that said person is a giant bag of HIV and other SIDS and allowed to live.
Thanks I'm going to go shit my pants.
You guys might laugh at me for saying this but schemes like this give me a lot of hope for our future. It really shows that (((they))) don't think of all the blowback INTENTIONALLY INFECTING PEOPLE WITH FUCKING HIV would do. Its just another wakeup for the normies and will lead to more pushes in the appropriate direction. If the OP is correct this really shows that they are running out of ideas as well.
Bring on the pozzed Euros. The 2 biggest superpowers aren't stupid enough to fall for this. America and Russia should just turn off the power and let all of these retards die and rebuild society afterwards.
This post also needs some attention.
Yup. Everyone read top post.
Does anyone else get sad when they think about how badly our sexual customs have been eroded. I mean I'm not that old, but I remember when staring at a woman's behind was considered extremely rude. That adultery was extremely taboo.
Does anyone have that pornography study where European countries, Russia, China, and Japan are breast-lovers, while the USA and most other countries are obsessed with butt?
No, but unproven nonsense is.
As loathe as I am to use the term 'conspiracy theory,' since it itself is a form of CIA mandated thought policing, the term here is apt, provided we use the scientific meaning of 'theory,' as opposed to the layman's useage.
Basic criminal pathology says that you need a means, a motive, and an opportunity before an accusation is made. If some random man in Italy drops dead, that's not the fault of the Clintons. But if an Arkansas political enemy of theirs dies under suspcious circumstances while on the campagin trail after threatening to leak sensitive material that would convict them of serious felonies and crimes, then you have a case to build.
Yes, refugees have HIV. Yes, they will spread it. These things will happen.
But no motivation has been provided for why this would benefit the governments involved. There have been some mumbled accusations of "muh big pharma," which is fine, but they already have hundreds of sources of renewable revenue from guaranteed lifetime repeat customers, which makes this a flimy podium to stand on. All the more so because unwashed brown hordes aren't going to have the cash to spend on these kinds of treatments and fixes, which makes a grand Jewish replacement scheme for the purposes of harvesting money inherently counterproductive.
So far, all I've see for the motivation is variations on "but the Illuminati always do bad things for no reason," which is Alex Jones tier /x/shit. It is fucking embarrassing thing that anyone on Holla Forums would fall for somebody's pet conspiracy hypothesis just because they tripfagged when they posted it. No proof has been shown for this happening that is any more compelling than "disease spread patterns were studied some times in the past decades," which is great, because I guess that means the Jews obviously want to use World of Warcraft to kill all humans on planet earth with a Black Death 2.0, since they were using that to study plague spread mechanics in 2007.
Correlation does not equal causation. Kikes aren't flooding Europe with niggers because they want everyone to catch AIDs and pay them money forever to have minimum symptoms.
They're flooding Europe with niggers because they hate Christianity and white people just that much. And because they broke the cardinal rule and actually drank their own Marxist kool aid.
civnat cuck detected (or just a moron).
The only civnat cuck here is you, since you seem to believe in Richard Spencer Globalism (we are all one white race).
never said that, but you seem dumb enough to think that national origin is a reliable indicator of genetic composition. Aryan genetics are aryan genetics; flaxen straight hair, blue eyes, rosy cheeks, long limbs=aryan=ideal. Are you some swarthy little shit who thinks his country of birth has guaranteed some kind of genetic purity?
What causes it ? user, do you live in the same planet as I do ? degeneracy causes it, heroin users and faggots mostly, but sometimes normal people die as well, like the poor guy in the 80's and early 90's that received blood transfusion from AIDS's ridden faggots and died because of it.
of whites, user. They're interested in depopulation of us.
Under rated post.
I've read "And the Band Played On" and conclusion the fags deserve it.
Do you even know what a fucking aryan is?
Lurk for at least two more years before you post again, plebbitfag.
What is this for conspiracy drivel?
Hurr muh HIV, HIV is stoppable you idiot. The medicines actually aren't that hard to make, the cost of them is just being kiked out by pharma industry. So goodluck killing people with a virus that is stoppable.
A much more proper reason is economical. Another reason is it creates a distraction, so that economical issues aren't that important and its about migration and solidarity instead of an EU fucking everyone over.
You forgot destroying priceless historic Church for the lulz. I'd like to cave his teeth in for the lulz. Not that one sin years ago should never be let go of, but I think he is blackpill pushing controlled-opp in any case.
Durp OP said people will live normal lives they'll just have to pay a huge life tax to big pharma.
A kike's greed is never satiated.
Lmgtfy: statnews.com/2017/02/13/california-hiv-transmission-criminal-penalties/
It was changed from being a felony to being a misdemeanor. Representatives say it is intended to fight "discrimination" and " homophobia".
this shit needs to stop
also
...
No wonder they have effectively decriminalized rape. Or at least, interracial rape with a white victim.
I remember reading somewhere that those who's ancestors were immune to the black death are also immune to HIV/AIDS. I'll search but can any user help me find the research on this? I feel like it was mainly white/chinese people with a few smatterings of those along the old silk road theoretically mixed in.
Black death gave many white people a resistance to HIV.
There are a lucky few that are completely immune due to their genealogy.
And then there's the niggers that are asymptomatic because after several generations of AIDS, they're children become carriers.
Many white people have this mutation, and it's why West Nile is such a big deal.
en.wikipedia.org
If you look at nigger and arab regions, West Nile is a non-issue because they don't carry the same mutation.
I'm lucky.
Guess that means you're free to stick fag blood in your ass, then.
Oh fuck. I'm praying that this is a work of fiction.
wew
That article does not talk about AIDS being caused by poppers, it clearly talks about Kaposi's sarcoma being caused by poppers.
tbf "raised a catholic/protestant/etc." rather than born into a catholic/protestant/etc. family is usually kike-speak for "he/she is one of us".
...
They do that anyway.
this is actually huge because europoors dont use condoms and africans arent aware of them. even if this isnt contrived, this will undoubtedly cause a huge outbreak. doesnt sweden or some scandinavian country also have laws in place that make it illegal to ask whether someone has AIDS?
yeah, letting in niggers would be totally fine if not for HIV
sage for low effort cuckchan jonestein tier shitpost
interesting. will have to review.
Well that's just fucking stupid, since hetero, non race mixing Aryans are immune to HIV
The problem is that it doesn't kill them.
I know that feel.
Did you find someone nice?
This sounds like complete bullshit to me, sorry.
Fuck.
So now I have to wear a condom at all times?
No, you find a good woman, get married and have three children.
This and I ain't even a virgin.
Let the degenerates get what they deserve.
(checked)
I needed to second this, also checked.
No, you find a good woman, get married and have MAX(3, X) children
FTFY
Underrated post. The race war may as well be a zombie apocalypse.
so,
1. Who makes the treatment? Somebody has patents. They outsource the manufacturing to somebody else.
2. Can any part of the product chain be connected to the development of the policy?
What are you talking about, an AIDS diagnoses will put your SSDI application straight to the front of the line.
DELET THIS
No seriously, do yourself a favor and delete these from your computer and never post anything like this again.
you know what, I'm actually curious about this.
I'm gay in the opposite direction and I have the opposite problem. Some people I haven't even touched will get super attached to me, when all I want is an easygoing relationship that doesn't leap fast into marriage(or doesn't at all because I don't think I have a right to be married) or even just to date and get used to someone.
Do gays on the other side of the fence really have troubles getting settled down?
GET THE FUCK OUT OF HERE YOU GODDAMNED FAGGOTS!!!!!!
REEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE
Isn't this that dude that speed runs zelda?
Sodomites are sodomites. No need to split hairs. All get the bog.
triggered
Why does this shit happen?
Because kikemonkey is an incompetent faggot and the entire site is compromised. We really need to go somewhere else.
This place really is becoming cuckchan 2.0 at the speed of light
That's called genocide, not depopulation.
Had a friend and his mom was procked by a dirty needle at the hospital on accident while she was preggers. He was born with HIV cause io a dumb hospital error. God damn Jews
Another case of jews out jewing other jews
hospitals get over run, pharma companies happy cuz while an individual may be able to declare bankruptcy/run away from debts governments cannot
symptoms are now normalized as they are "just how my new gender acts"
constant rape and bloodshed as we have seen, great ways to spread the plagues and overburden hospitals even more, increasing more demand for big pharma's products
eventually this overburdens the governments into total collapse and the western world as we know it dies by plague spread by mudbloods
Teva is heavily Soros-associated. I believe Huma also had a role in their money laundering.
Someone is a poor fag. You protect yourself from competition with monopolies. Can't do that anymore so you make the barriers of entry too high.
If you kill off White people, almost everything that makes kikes wealthy goes with them.
They make generics. Which as far as pharma goes, makes them a minnow.
You don't need to invite some crisis to sell more drugs. People have already adopted shitty lifestyles that have them on a number of things from birth to grave. The risk/reward isn't there. The status quo suits these devils just fine.
Yes I'm sure, thats why they dont have all sorts of machinations at play all the time right?
...
BETA VIRGIN GONNA RISE
THE ELITE
Normies are gonna die because of nignog AIDS !
AIDS is a disease of homosexuals, blacks and those who have sex with those who consort with them.
Upstanding heterosexuals simply don't contract HIV at a significant rate. The CDC statistics on heterosexual infection rates are duplicitous and misrepresented because they only apply to those who have sex with a high risk person.
High risk group examples: blacks, gays, IV drug users, women who have sex with bisexual men etc.
The annual number of men contracting HIV from heterosexual sex with someone not identified as high risk is about the same as the total number of people struck by lightning each year in the USA (around 30 to 50). In fact the total for White heterosexual men is so low that it is left out of the official infographics; including it would raise controversy because every other group has much higher rates of infection. To find it you have to look at the total labelled "other" and subtract those who infected by such things as needlestick and mother to child transmission.
tl;dr sexually active straight White men who avoid sex with women known or suspected to be "high risk" have about the same chance of contracting HIV as they do of being struck by lightning.
Yes, Whites as a group are catching HIV from straight sex in increasing numbers, but most of these cases are women having sex with Blacks, especially the growing body of female sex tourists who travel to such places as Jamaica for this specific purpose.
the media damage control method is to call this 'acquired abroad' and imply that it is horny White businessmen bringing it back, but the facts tell a different story.
For men, HPV should be the more acute concern, given that 40-50% of young women carry a cancer-causing strain, readily transmitted by the cunnilingus popularized by mainstream female sources as being virtually expected and required to "please her."
Oh my fucking god. What the fuck?????? Rip. I'm out, monk mode it is then
and here i was thinking ppl were too gullible to see it, i should have put a pic next to it
SHEEEEEIIIIIIIIITTTTT
Weeeeeeehhhhhhllllllllllllllll-uhh, maybe
Sorry, not buying it.
I watched Dawn of the Dead not long ago and it sure as hell is starting to resemble a Zombie scenario.
...
This pasta is older than half the posters in this thread, come up with some new material you larping nigger
Theory is bunk. More STDs would be a good thing for Europe. More STDs make people more careful when it comes to sex. Promiscuity is already declining and ((they)) want to add the threat of a deadly illness to that? Nope.
And like some others pointed out throughout the thread there's a bigger NWO meme that's clearly bullshit: Depopulation. Depopulation is disinfo. The elites are clearly doing whatever they can to increase the world population, not to reduce it.
B-but AIDS is (((treatable))), goy! No worries, goy! Now get back to the orgies! Mud babies don't make themselves, goy!
[hand rubbing intensifies]
OVEN THE FUCKING KIKES ALREADY DAMMIT! SKIP THE GAS! STRAIGHT TO THE FUCKING OVENS WITH THEM!
According to Teva's site, they're the largest "generics" pharma company in Europe.
US is the largest HIV medication market in the world, followed up by France. Look up those Paris walkthroughs on youtube and you'll see how many africans are flooding their streets. Japan is also the smallest market for HIV meds. Just another way to make a profit out of pressuring nips to take in refugees, eh?
haha jokes on them I never have sex. seems i'm immune to this plot, jews
You should be put in a forced labor camp until you regain enough testosterone to willingly kill yourself